Non-Believers Giving Aid
-
Recent Posts
Recent Comments
- arensb on Apologetics Is A Joke
- Worthey Brisco on Apologetics Is A Joke
- arensb on Kitty Theodicy
- Benney on Kitty Theodicy
- arensb on Floristgate: How Petty Can You Get?
Archives
Twitwaffle
Categories
Links
Podcasts
Weblogs
Meta
Monthly Archives: December 2009
The Onion Can’t Keep Up
Onion headline, Dec. 22: Weed Delivery Guy Saves Christmas Associated Press headline, today: Search of car turns up gift-wrapped marijuana
Ack! Missed Milestone
I just happened to notice that that last post was #666, a milestone of sorts. I’d meant to commemorate it with something suitably satanic, but missed it. Anyway, enjoy post #667, the Neighbor of the Beast.
Sing Like You Mean It
What with it being late December and all, I’ve been listening to a lot of Christmas music lately. And one thing I’ve decided is that I really need to separate my collection into “Christmas music (straight)” and “Christmas music (ironic)”. … Continue reading
Posted in Music, Things I've Learned
Tagged Bing Crosby, Christmas, Etta Jones, Mannheim Steamroller, Navidades Radioactivas, William Hung, Wing
4 Comments
Followup on Luke 6:30
As I mentioned earlier, I asked commenter Flabberghasted for money, and he came through. Which left me with a not-terribly-fungible Amazon gift card, and the question of what to do with it. I wound up taking Shelley’s advice: used the … Continue reading
Posted in Religion, Site News
Tagged charity, Christianity, Flabberghasted, Secular Student Alliance
Leave a comment
Drugs in the Czech Republic
Because USian media outlets don’t seem to have reported this story: Prague – The Czech government today set the drug possession limits under which the possession of up to 1.5 grammes of heroin, up to one gramme of cocaine and … Continue reading
Oral Roberts Dead
The AP is reporting that Oral Roberts is dead at 91. I guess he failed to raise the $8 million ransom to keep the Lord from calling him home. The obit also mentions Oral Roberts University’s financial problems. Maybe they … Continue reading
Ray Comfort, Plagiarist?
Looks like Ray Comfort found it too hard to write a 50-page introduction to Origin on his own: Metropulse.com, a Knoxville, TN local paper, has a story about Stan Guffey, a University of Tennessee lecturer who wrote a brief bio … Continue reading
Posted in Creationism, Evolution, FFS, News
Tagged plagiarism, Ray Comfort, The Origin of Species
4 Comments
Geek T-Shirt
I just had an idea for a geeky T-shirt: In just seven days… TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG … I can make you a man! (For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the … Continue reading
Posted in :-), Geek, Science
Tagged biology, Charles Atlas, genes, Rocky Horror Picture Show, SRY, T-shirt
Leave a comment
Kent Hovind’s Dissertation
I think I just came a little in my mouth. But then again, I’m a glutton for punishment. Kent Hovind’s “doctoral dissertation” at Patriot “University” has been released on Wikileaks. Grab it while it’s hot! Those who lack the patience … Continue reading
Luke 6:30
Luke 6:27-31 (NIV): 27“But I tell you who hear me: Love your enemies, do good to those who hate you, 28bless those who curse you, pray for those who mistreat you. 29If someone strikes you on one cheek, turn to … Continue reading
