Monthly Archives: December 2009

The Onion Can’t Keep Up

Posted on December 26, 2009 by arensb

Onion headline, Dec. 22: Weed Delivery Guy Saves Christmas Associated Press headline, today: Search of car turns up gift-wrapped marijuana

Posted in :-), News | Tagged , , , | Leave a comment

Ack! Missed Milestone

Posted on December 23, 2009 by arensb

I just happened to notice that that last post was #666, a milestone of sorts. I’d meant to commemorate it with something suitably satanic, but missed it. Anyway, enjoy post #667, the Neighbor of the Beast.

Posted in Site News | Tagged | Leave a comment

Sing Like You Mean It

Posted on December 22, 2009 by arensb

What with it being late December and all, I’ve been listening to a lot of Christmas music lately. And one thing I’ve decided is that I really need to separate my collection into “Christmas music (straight)” and “Christmas music (ironic)”. … Continue reading →

Posted in Music, Things I've Learned | Tagged , , , , , , | 4 Comments

Followup on Luke 6:30

Posted on December 22, 2009 by arensb

As I mentioned earlier, I asked commenter Flabberghasted for money, and he came through. Which left me with a not-terribly-fungible Amazon gift card, and the question of what to do with it. I wound up taking Shelley’s advice: used the … Continue reading →

Posted in Religion, Site News | Tagged , , , | Leave a comment

Drugs in the Czech Republic

Posted on December 17, 2009 by arensb

Because USian media outlets don’t seem to have reported this story: Prague – The Czech government today set the drug possession limits under which the possession of up to 1.5 grammes of heroin, up to one gramme of cocaine and … Continue reading →

Posted in News | Tagged , | Leave a comment

Oral Roberts Dead

Posted on December 15, 2009 by arensb

The AP is reporting that Oral Roberts is dead at 91. I guess he failed to raise the $8 million ransom to keep the Lord from calling him home. The obit also mentions Oral Roberts University’s financial problems. Maybe they … Continue reading →

Posted in News, Religion | Tagged , | 2 Comments

Ray Comfort, Plagiarist?

Posted on December 14, 2009 by arensb

Looks like Ray Comfort found it too hard to write a 50-page introduction to Origin on his own: Metropulse.com, a Knoxville, TN local paper, has a story about Stan Guffey, a University of Tennessee lecturer who wrote a brief bio … Continue reading →

Posted in Creationism, Evolution, FFS, News | Tagged , , | 4 Comments

Geek T-Shirt

Posted on December 12, 2009 by arensb

I just had an idea for a geeky T-shirt: In just seven days… TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG … I can make you a man! (For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the … Continue reading →

Posted in :-), Geek, Science | Tagged , , , , , | Leave a comment

Kent Hovind’s Dissertation

Posted on December 9, 2009 by arensb

I think I just came a little in my mouth. But then again, I’m a glutton for punishment. Kent Hovind’s “doctoral dissertation” at Patriot “University” has been released on Wikileaks. Grab it while it’s hot! Those who lack the patience … Continue reading →

Posted in Creationism, Evolution, News | Tagged , | 30 Comments

Luke 6:30

Posted on December 9, 2009 by arensb

Luke 6:27-31 (NIV): 27“But I tell you who hear me: Love your enemies, do good to those who hate you, 28bless those who curse you, pray for those who mistreat you. 29If someone strikes you on one cheek, turn to … Continue reading →

Posted in Religion, Site News | Tagged , , , | 5 Comments