Epsilon Clue

Onion headline, Dec. 22:
Weed Delivery Guy Saves Christmas
Associated Press headline, today:
Search of car turns up gift-wrapped marijuana

I just happened to notice that that last post was #666, a milestone of sorts. I’d meant to commemorate it with something suitably satanic, but missed it.
Anyway, enjoy post #667, the Neighbor of the Beast.

What with it being late December and all, I’ve been listening to a lot of Christmas music lately. And one thing I’ve decided is that I really need to separate my collection into “Christmas music (straight)” and “Christmas music (ironic)”. It hurts my brain when I put the MP3 player on shuffle and it goes [...]

As I mentioned earlier, I asked commenter Flabberghasted for money, and he came through. Which left me with a not-terribly-fungible Amazon gift card, and the question of what to do with it.
I wound up taking Shelley’s advice: used the card to knock $50 off my Christmas shopping, and then made a $50 donation to the [...]

Because USian media outlets don’t seem to have reported this story:
Prague – The Czech government today set the drug possession limits under which the possession of up to 1.5 grammes of heroin, up to one gramme of cocaine and up to two grammes of methamphetamine (pervitine) will not be punishable as of New Year.
Czechs will [...]

The AP is reporting that Oral Roberts is dead at 91. I guess he failed to raise the $8 million ransom to keep the Lord from calling him home.
The obit also mentions Oral Roberts University’s financial problems. Maybe they could join with Bob Jones University to form Oral BJ U. (Might not want to invite [...]

Looks like Ray Comfort found it too hard to write a 50-page introduction to Origin on his own: Metropulse.com, a Knoxville, TN local paper, has a story about Stan Guffey, a University of Tennessee lecturer who wrote a brief bio of Charles Darwin. Turns out that bio bears a striking resemblance to the first few [...]

I just had an idea for a geeky T-shirt:
In just seven days…
TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA
TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT
ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG

… I can make you a man!

(For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the Y chromosome and makes embryos develop as males.)
(Well, mostly.)

I think I just came a little in my mouth. But then again, I’m a glutton for punishment.
Kent Hovind’s “doctoral dissertation” at Patriot “University” has been released on Wikileaks. Grab it while it’s hot!
Those who lack the patience to read the whole thing may wish to read Karen Bartelt’s analysis.
(HT PZ.)

Luke 6:27-31 (NIV):
27“But I tell you who hear me: Love your enemies, do good to those who hate you, 28bless those who curse you, pray for those who mistreat you. 29If someone strikes you on one cheek, turn to him the other also. If someone takes your cloak, do not stop him from taking your [...]