Geek T-Shirt

I just had an idea for a geeky T-shirt:

In just seven days…

TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA
TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT
ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG

SRY protein

… I can make you a man!

(For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the Y chromosome and makes embryos develop as males.)

(Well, mostly.)

About arensb

He's just zis guy, you know?
This entry was posted in :-), Geek, Science and tagged , , , , , . Bookmark the permalink.

Leave a Reply

Your email address will not be published. Required fields are marked *

*

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>