Epsilon Clue

Online polls are:

A reliable gauge of public opinion

Useless

PZ Myers

CmdrTaco

No

Needs more options

* Not scientific.

I normally don’t read Denyse O’Leary, because I like Canada too much to taint my mental image of it with her ignorant hackery. But for the past few days, she’s had a series of posts at Happy Dembski’s House of ID Circle-Jerk called about “Access Research Network’s top ten media-related intelligent design stories [...]

Today’s WSJ has an article about the Proposition 8 suit in California:
Defenders of California’s ban on same-sex marriage began making their case Monday, countering the plaintiffs’ argument that gays and lesbians are subject to discrimination.
Which is all well and good until you see the photo that ran next to the article:

So this guy is holding [...]

Never Comes the Day, The Moody Blues
Forever and a Day, The Offspring
One Hundred Years, The Cure
Sixteen Years, Robyn Hitchcock & The Venus 3
Eleven Years, New Model Army
A Thousand Days, The Offspring
A Thousand Hours, The Cure
One Week, Barenaked Ladies
7 Days, Assemblage 23
In Only Seven Days, Queen
Six Days, The Dead Milkmen
One of These Days, Pink Floyd
The Day [...]

Onion headline, Dec. 22:
Weed Delivery Guy Saves Christmas
Associated Press headline, today:
Search of car turns up gift-wrapped marijuana

I just had an idea for a geeky T-shirt:
In just seven days…
TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA
TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT
ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG

… I can make you a man!

(For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the Y chromosome and makes embryos develop as males.)
(Well, mostly.)

Are You Ready Eddy? – Emerson, Lake & Palmer
Ready an’ Willin – Whitesnake

Are You Receiving Me? – XTC
Talking Loud and Clear – Orchestral Manoeuvres in the Dark

So What Happens Now? – Art of Noise
We All Stand – New Order

What Time Is It? – Spin Doctors
10:15 Saturday Night – The Cure

Where are the Prawns? – The [...]

I just saw this go by in the spam report.
Why hello associate forum people! I straight wanted to interpose myself here as this looks like a sheer attractive forum! I myself am provocative in things like writeing and computer revamping so if anyoune needs steal forgive me identify! I also Suffer from Sciatica so if [...]

Slashdot has a story entitled Google Under Fire For Calling Their Language “Go”.
I can certainly understand that: Go has got to be the least-googlable language name since C.

According to James Ussher, the world was created on October 23, 4004 BC.
So happy 6012th birthday, world!