Geek · Science

Geek T-Shirt

I just had an idea for a geeky T-shirt: In just seven days… TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG … I can make you a man! (For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the Y chromosome and makes embryos develop as males.) (Well, mostly.)